rennaisseance - Viv’s Shitpost Dumpster Fire

rennaisseance

Viv’s Shitpost Dumpster Fire

Viv | She/her

90 posts

Latest Posts by rennaisseance

rennaisseance
1 month ago
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's
Was Reminded To Post My Mothman Stickers I'll Be Selling This Weekend In St. Catherine's

Was reminded to post my mothman stickers i'll be selling this weekend in st. Catherine's <3

rennaisseance
2 months ago

ok

I’ve Finally Made Something Again

i’ve finally made something again

rennaisseance
3 months ago

Quietly losing my mind over the fact that Elon Musk has straight up orchestrated a coup of our executive branch and like....I don't even know what, if any, system we have in place to fix this. Like... He's just taken control of the money and locked out the actual appointed officials. What the fuck.

rennaisseance
3 months ago

Literally sobbing. A judge, a US judge defended us. A judge brought up intersex people, uaing the term intersex, to *defend* us by not allowing our erasure. I'm having a lot of feelings right now

Literally Sobbing. A Judge, A US Judge Defended Us. A Judge Brought Up Intersex People, Uaing The Term
rennaisseance
3 months ago
rennaisseance - Viv’s Shitpost Dumpster Fire
rennaisseance
4 months ago
I Shall Die, But That Is All That I Shall Do For Death;

I shall die, but that is all that I shall do for Death;

I am not on his payroll.

I will not tell him the whereabouts of my friends

nor of my enemies either.

Though he promise me much,

I will not map him the route to any man’s door.

Am I a spy in the land of the living,

that I should deliver men to Death?

Brother, the password and the plans of our city

are safe with me; never through me

Shall you be overcome.

—Edna St. Vincent Millay

rennaisseance
4 months ago

My mother survived the genocide in Cambodia. Her father, my grandfather, was killed due to their neighbors snitching out of jealousy that her family still had some small amount of livestock.

They didn’t receive shit in return for snitching, and honestly they probably died in the genocide too.

Just something to think about.

Its about to be real lucrative to be a snitch. Guard your information. And guard your friends information.

rennaisseance
4 months ago

I'm Abdelrahman, 22 years old. My journey has been marked by loss and resilience. When I was 18, my father passed away from COVID-19. Determined to build my own future, I pursued an education in multimedia technology, balancing my studies with work to cover my expenses. I was preparing to establish my home and life.

I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my
I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my

My mother: the princess whom we strive to make happy and satisfy. ❤️️

I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my

However, the war in Gaza, especially in the north, brought devastating tragedy. My home, university, job, and family were all destroyed in the conflict. While my family moved to the south, I was in the north, facing famine and moving from place to place, trying to survive.

I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my

Our street used to be lively and full of people, but it is no longer like that.

I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my

I have witnessed countless difficult and painful scenes while escaping death multiple times. In northern Gaza, life is reduced to a cycle of fleeing from danger and searching for food amidst the rubble of destroyed homes.

I have survived many times,I was hit by a missile in previously destroyed house

This picture is enough to show our suffering in getting flour to survive.

I'm Abdelrahman, 22 Years Old. My Journey Has Been Marked By Loss And Resilience. When I Was 18, my

My dream is to travel abroad with my mother and sister to continue my education and develop my practical skills. For the past eight months, I have been unemployed, focusing on self-improvement and hoping for a better future.

Your help can save a family from death, it can save a dream, an ambition, or a success, so please help me by donating or publishing my story so that I can save my family.

Donate to From War to Education: Abdelrahman Resilient Journey, organized by Abdallah Alanqar
gofundme.com
Hello, I'm Abdelrahman, 22 years old. My journey has been ma… Abdallah Alanqar needs your support for From War to Education: Abdelrahman
rennaisseance
4 months ago

I want you to remember:

The fascists hate you too and they just will pretend otherwise until after they've killed the rest of us, before they turn on you.

rennaisseance
4 months ago

she genetic code on my genome till i GATATATAGGACTAGATAGTA

rennaisseance
4 months ago
rennaisseance - Viv’s Shitpost Dumpster Fire
rennaisseance
4 months ago

Hate how lighting a candle does wonders to my mood. Like wowwww. Grug like fire? Grug not sad anymore because Fire in Cave? Wow. Real predictable of Grug.

rennaisseance
5 months ago
Donate to Helping my family to save us from the Gaza war, organized by Mohammed Jamil
gofundme.com
Mohammad Nashwan: The Story of a Father Who Dreams of Rebuilding His Lif… Mohammed Jamil needs your support for Helping my family to save us

I am Lubna from Gaza. I live in a torn tent. I have 7 children. In the midst of war and rain, I need flour. Please help me with $1,000 for the flour and the tent.

gofund.me/a5658683

I Am Lubna From Gaza. I Live In A Torn Tent. I Have 7 Children. In The Midst Of War And Rain, I Need
rennaisseance
5 months ago

Help Hyam Shehab save her family

Donate to Help Zaen and Yehya to get out of Gaza, organized by Mahmoud Salama
gofundme.com
I am Muhammad Shehab from Gaza These are my sons Zaen and Yahya I wr… Mahmoud Salama needs your support for Help Zaen and Yehya

@hyamshehabfamile and her family are once again facing an unforgiving winter in the midst of ongoing oppression, disease, a lack of food and clean water, and inhumane conditions.

Their main goal is €60,000 to reach safety, but they are setting a temporary goal of €10,000 by the end of the week to cover the costs of warm clothes, food, and other immediate needs for 6 people.

As of December 2, 2024, this campaign has raised €3,443 / €10,000

Please donate if you can and share! This is a time sensitive short-term goal

This campaign is line 127 on the Gaza Vetters list

tagging for reach

@anamiques @vague-humanoid @andromachos @wutheringheightsfilm @solroja @lesboevils @evilbisexualonline @lovetren @xenomorphique @bedcorpse @keithers @mossymagpie @in-need-of-another-name @thetragiclown @soggy-paradise @same-png @ispyspookymansion @dickmaster @geometric-orcas @angelsaxis @vamprisms @heritageposts @colorisbyshe @mpregbts @dlxxv-vetted-donations @chilewithcarnage @2spirit-0spoons @c-u-c-koo-4-40k @femmefitz

rennaisseance
5 months ago

answering a couple questions i got on this post since i realized ppl genuinely wanna know:

tl;dr:

israel lets very, very little aid get into gaza. even the UN can't get in as much as they want to. funding individual families, gazan led initiatives, and mutual aid collectives operating out of gaza ensures gazans can provide for themselves and pay for the extremely expensive aid that is available.

with all the civil infrastructure destroyed by israel, the situation on the ground has devolved into unrestricted capitalism, driving up the price of aid (that should be free!). this makes it more urgent for people to have funding for daily survival.

the post linked above has examples of how donating to individual families can help a lot. if you want to help more than one family at a time, there are many gazan-led initiatives focusing on rebuilding their infrastructure and distributing aid fairly that are worth donating to instead of large charities that already get the majority of donations.

as i mentioned in the last post: @/careforgaza on twitter is a nonprofit started by gazans, it's been endorsed by multiple palestinian journalists.

the sameer project is a collective organized by diaspora palestinians offering emergency shelter to gazans.

ele elna elak is a project aiming to bring water, food, shelter, etc. to gazans and has been promoted by bisan owda.

and the municipality of gaza itself is fundraising to rebuild water infrastructure.

all of these organizations are active inside gaza right now and are being run by gazans. if anyone knows of other gazan-led mutual aid projects, nonprofits or charities feel free to link them in the notes! hope this helped!

long answers under the cut!

Answering A Couple Questions I Got On This Post Since I Realized Ppl Genuinely Wanna Know:

if you wanna donate to a charity that's absolutely fine, but the thing is most charities (and even the UN!) are unable to make it into gaza in the first place, leaving aid rotting at the egyptian side of the border or subject to israeli settler attacks

not to mention, charities and nonprofits also maintain a paternalistic colonial relationship with the indigenous people they are trying to help, determining what aid they need for them instead of returning power to them and letting them make their own choices

i'm not here to say that one option is better than the other, just that they achieve different things and are equally legitimate. there's an attitude among people who question the legitimacy of these gofundme campaigns that somehow the people promoting them are telling them not to donate to charities. nobody is stopping you from donating to charities. we are just asking that you do not dehumanize the very real gazans in your inbox just because their method of asking for aid is more direct and risky.

Answering A Couple Questions I Got On This Post Since I Realized Ppl Genuinely Wanna Know:

unfortunately that's exactly what has happened. because israel destroyed all of gaza's more formalized infrastructure, it seems that organized crime and rampant inflation has taken its place. aid is supposed to be free, but in order to save for evacuation or the cost of living, people have started selling them at an inflated price. and aid that is truly free attracts intense, large crowds that are dangerous to navigate.

Answering A Couple Questions I Got On This Post Since I Realized Ppl Genuinely Wanna Know:

this was posted on abc a few days ago

it's pure, unrestrained capitalism. i've had multiple palestinians describe this situation to me confidence. that's why everything's so expensive now. why people have to rent out tiny plots of land for their tents to sit on, why my friend @siraj2024 still has to buy tarps to cover the broken windows of the overpriced bombed out apartment he rented, and why a bag of flour can cost a thousand bucks in the north.

even before israel closed and then bombed the rafah crossing, the egyptian hala travel agency was only allowing people to cross the border if they paid a hefty $5000 USD per adult / $2500 USD per child bribe. it denies doing this, but the hundreds of stories from palestinians say otherwise.

with regard to the economy, here in america we saw something similar happen in the wake of hurricane helene and milton. the podcaster margaret killjoy describes how she saw dual economies rise after asheville was fully cut off from the rest of the country - some people offered each other supplies for free in a sort of mutual aid honor system, and some people required payment when they lent supplies because they themselves needed to buy stuff for their families. these dual economies exist in gaza too. and this means they all still need money to survive.

rennaisseance
5 months ago

while you’re here i’d like to draw your attention to @alkliliyfamliy and their campaign! they’re only 11% to their goal, and even a little bit helps!

While You’re Here I’d Like To Draw Your Attention To @alkliliyfamliy And Their Campaign! They’re
rennaisseance
5 months ago

I write this message as my heart and body freeze from the unbearable cold. I swear to you, I am trembling with every part of me, feeling the cold coursing through my veins, almost stopping my heart. Please, don't let my story fade into silence; don't stop sharing it. I beg you with all I have, keep my voice alive, for I fear my screams will become mere whispers lost in the void. I implore you, help me, for the night is long, the cold is merciless, and I am living moments where despair intertwines with pain.

I Write This Message As My Heart And Body Freeze From The Unbearable Cold. I Swear To You, I Am Trembling

Save Mohammed and his family from the Gaza Genocide
Chuffed
Hi, I'm a grad student in NYC who has been active in Palestine solidarity for a while and am absolutely horrified and heartbroken by the amo
rennaisseance
5 months ago

your life is not an optimization problem

rennaisseance
5 months ago
Feeesh

Feeesh

rennaisseance
5 months ago
A Small Painting Of My Cat, Rosie!

a small painting of my cat, Rosie!

im away from home and missing her haha

rennaisseance
5 months ago

Briana Boston faces terrorism charges and CEOs are getting free therapy

Briana Boston Faces Terrorism Charges And CEOs Are Getting Free Therapy

Briana Boston is a 42 year old mother of three from Florida who is under house arrest for expressing her frustration at her insurance (which she PAYS for) who denied her claim. She owns ZERO guns and doesn't have a criminal record.

She was originally held in prison for $100,000 bail. They have not dropped the charges and she is under house arrest even after widespread backlash.

They are trying to charge her with terrorism. They want her to spend 15 years in prison.

They are calling her a Luigi Mangione copycat. As if she killed someone. She made a indirect, not at all credible threat.

Meanwhile...

Briana Boston Faces Terrorism Charges And CEOs Are Getting Free Therapy

I want every woman who has ever faced threats online, stalking, etc to bring this Briana Boston up at every opportunity. Every time you were told by police that there was nothing they could do, know that they not only CAN do something, but they WILL do something, just not for you.

rennaisseance
5 months ago

Okay, so, friends. Occasionally I see an American post on here about “guillotine the rich,” and it turns out that “rich” means “anyone making over $50k.”

We need to clear this shit up REAL fast, because otherwise it’s gonna wind up like the French Revolution, where more middle class and poor people were killed for being “class traitors” than actual nobles. (Did you know that France has more nobles today than during the French Revolution? While there were a few showy executions, many nobles did just fine or experienced minor setbacks.)

If someone makes $60,000 a year, they are making about twice as much as a full time worker making minimum wage in California, Arizona, Colorado, Connecticut, DC, Hawaii, Illinois, Maine, Maryland, Massachusetts, New Jersey, New York, Oregon, Rhode Island, or Washington State.

Brian Thompson, the CEO of United HealthCare who was just assassinated in New York City, earned $10 million a year, which means he earned 333 times minimum wage in those states. Basically, he cleared an annual minimum wage salary in just over a day. And that “rich” person making $60k/year that you want to guillotine? He made their salary in a bit over two days of a year.

So he was rich, right?

Well. Tesla is trying to give Elon Musk a pay package of $101 billion. That is 10,100 times what Brian Thompson earned and 3,366,667 times more than a minimum wage worker. (Tesla hasn’t been successful yet because of a complicated lawsuit from a shareholder, but they’ll get there.) If you are a minimum wage worker, Elon Musk makes more every SECOND than you do in a year. And that “rich” person who you want to guillotine? He makes their salary in about 1.6 seconds. Even when he’s sleeping.

Now, remember. The Muskrat also is the head of SpaceX, the Boring Company, X.ai, and X.com, so this is just ONE pay package for him.

What I’m saying is — you have much more in common when it comes to economic grievances with someone earning $60,000 (or even $200,000) than the ultra wealthy that have real power. They are not the people you should expend your energy on.

rennaisseance
5 months ago

Remember earlier this year when Boeing very clearly had a whistleblower executed? And law enforcement didn't even look for anyone or release any info about it or anything?

People keep comparing Luigi Mangione's case to the subway murderer who got off because of systemic eugenics, but I think there's something more apt about the fact that a CEO had someone executed in recent memory, with zero attempts to find a culprit, while they spared no expense at all to find (and probably frame, it's beginning to look like) someone who shot a CEO. It's always fine to slaughter if you're rich, but if you kill the rich, they will hunt you down.

rennaisseance
5 months ago
In Sonic Adventure 2′s Security Hall Level There’s A Bunch Of Money Flowing About Freely. This Is

In Sonic Adventure 2′s Security Hall level there’s a bunch of money flowing about freely. This is the texture used on that money. [Sonic The Hedgeblog] [Support us on Patreon]  

rennaisseance
5 months ago
A Friend's Minecraft OC!

A friend's Minecraft OC!

based off her appearance in Cobblemon

this piece was genuinely a lot of fun to work on

and I'm learning how to render yippee!

rennaisseance
5 months ago
So I've Been Sitting On The Finished Version Of My Bnuuy For Months Now. I Figured It Was Finally Time

so I've been sitting on the finished version of my bnuuy for months now. I figured it was finally time to post it :3

ignore all the shitpost practice sketches

rennaisseance
5 months ago
Just A Bored-at-work Sketch Page :P

just a bored-at-work sketch page :P

I'm very excited for season 2

also finn and marceline I guess

rennaisseance
5 months ago
Vi | Arcane Act 2

Vi | Arcane Act 2

a little study of act 2 Vi

Vi my beloved

rennaisseance
5 months ago
Momo! | Stray

Momo! | Stray

I've been replaying Stray. Momo my beloved

this was meant to be a practice sketch, but I got a little carried away

process under the cut

rennaisseance
5 months ago
This Woman Was Arrested For WORDS.

This woman was arrested for WORDS.

We should rally for her as much as the guy who actually shot someone. Push back.

Explore Tumblr Blog
Search Through Tumblr Tags